rs11748977 chr5:137192758 T>A
- Sequence
taaagtgaatgagctagaactgca[T/A]gaaccaacaacacggaaaaacctc
- ASB in cell types
- VCaP (prostate carcinoma) A549 (lung carcinoma) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 0.01 | 0.90 | 1.95 | |||
| A549 (lung carcinoma) | -0.13 | 0.71 | 2.14 | |||
| LHSAR (prostate epithelial cells) | 1.35 | -0.95 | 1.50 |
Items per page:
1 – 3 of 3