rs11751362 chr6:21955733 A>G
- Sequence
ttgactttgtttcttgactaaata[A/G]acgttcgttgaatgaattagacga
- ASB in cell types
- VCaP (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.29 | -1.16 | 3.20 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, chronic kidney disease, diastolic blood pressure (dbp), hdl cholesterol, serum creatinine, systolic blood pressure (sbp)