rs11755164 chr6:44671447 T>C
- Sequence
agggcaacgatttacatcaatgtg[T/C]tcagccttcccacttcaggttccc
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -3.82 | 2.06 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cortical volumetric bone mineral density (bmd), cystatin c in serum, femoral neck areal bone mineral density (bmd), femoral neck bone mineral density (bmd) (females), infant head circumference, lumbar spine areal bone mineral density (bmd), lumbar spine bone mineral density (bmd) (female), lumbar spine bone mineral density (bmd) (male), lumbar spine bone mineral density (bmd), supt3h gene expression in adipose tissue, supt3h gene expression in whole blood
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Testis