rs11762726 chr7:155685339 T>C
- Sequence
tatgttagtgctttgaaagcagtg[T/C]ggtaattctttttaattagtaaca
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.13 | 0.67 | 1.51 | |||
| GM12878 (female B-cells) | 0.78 | 0.35 | 1.32 |
Items per page:
1 – 2 of 2