rs1176542 chr1:157163685 G>A
- Sequence
ctagcccccggggtcttttcaagg[G/A]caatgactctgcatctcggtcttt
- ASB in cell types
- HEK293 (embryonic kidney) MM1.S (plasma cell myeloma) KMS-11
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.73 | 0.42 | 1.36 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, hypertension (early onset hypertension), long version of the conners parent rating scale (crps-r:l) in conduct disorder and attention deficit/hyperactivity disorder (adhd), suicide attempts in bipolar disorder (substance abuse/dependence)