rs11767162 chr7:2477839 C>T
- Sequence
gaggatgagcgtgcctgccctccc[C/T]ggccacatccgcgtccccatcctg
- ASB in cell types
- K562 (myelogenous leukemia) testis
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.17 | 0.88 | 1.92 | |||
| testis | -1.30 | 1.60 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg