rs117698521 chr1:234478644 G>C
- Sequence
gctccagtagcggcccgtcctcgc[G/C]gggccgcaaacatggcccgacggc
- ASB in cell types
- foreskin keratinocyte MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.26 | 0.33 | 1.39 | -3.78 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg