rs11773707 chr7:157340264 G>C
- Sequence
ctcagaaatgattctgttcaaaat[G/C]tggtttggttaaatttgtgcagga
- ASB in cell types
- K562 (myelogenous leukemia) erythroid progenitors hepatocytes CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.28 | 0.77 | 1.52 | |||
| erythroid progenitors | 2.10 | n/a | 2.50 | |||
| hepatocytes | -0.47 | 0.98 | 1.11 | |||
| CD34+ stem cells-derived erythroblasts | -3.00 | 2.18 | 2.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.64 | -0.04 | 2.09 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood