rs11778430 chr8:29114041 C>T
- Sequence
tatgaggaatgatttaagagtgca[C/T]ggtcattgtttatgctgactgcgc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.99 | -0.26 | 1.91 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), infant head circumference, late onset alzheimers disease, ldl cholesterol change with statins, parkinsons disease, partial epilepsy, total cholesterol, total cholesterol change with statins, triglycerides change with statins