rs11783773 chr8:124896373 T>C
- Sequence
aacagataatgctagtgattgttc[T/C]tgtcagcttgtaataggcaggata
- ASB in cell types
- VCaP (prostate carcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.36 | 1.03 | 1.70 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.16 | 0.47 | 1.57 |
Items per page:
1 – 2 of 2