rs11787347 chr8:17608804 T>C
- Sequence
caagtgtgagtgtggagcggctga[T/C]aggaaggagagaaggcagctgtga
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ bone marrow cell-derived erythroid progenitors primary endothelial colony-forming cells
- ASB for transcription factors
- TAL1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 2.24 | 1.30 | 1.70 | -5.37 | Concordant | |||
| GATA1_HUMAN | 1.46 | -0.99 | 1.50 | -5.02 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Testis, Thyroid