rs117878047 chr19:18676050 G>C
- Sequence
ccaggatcttggaaagcaggatgg[G/C]ggtctggatgtagggaggtcaatg
- ASB in cell types
- HEK293 (embryonic kidney) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.44 | -0.14 | 1.96 | |||
| epithelial cell of prostate | 1.40 | -1.09 | 1.00 |
Items per page:
1 – 2 of 2