rs11799947 chr1:181424807 G>T
- Sequence
tctcccccaagactctgcagcctg[G/T]tgctcaagccggatcggcccgttc
- ASB in cell types
- foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.05 | -2.00 | 1.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.80 | -0.48 | 1.98 |
Items per page:
1 – 2 of 2