rs11800505 chr1:44721658 G>A
- Sequence
tgggaggattgcttgagcatggga[G/A]atggaggttgtagtgagccgcgac
- ASB in cell types
- HepG2 (hepatoblastoma) GM12891 (male B-cells) D341 Med (medulloblastoma) Th2-cells
- ASB for transcription factors
- PO2F2_HUMAN TYY1_HUMAN KDM5B_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PO2F2_HUMAN | 2.28 | -1.69 | 1.50 | n/a | No Hit | |||
| TYY1_HUMAN | 1.52 | -0.72 | 1.47 | n/a | No Hit | |||
| KDM5B_HUMAN | 2.16 | -2.28 | 1.50 | n/a | n/a | |||
| CREB1_HUMAN | 0.54 | 1.08 | 1.48 | n/a | No Hit | |||
| STA5A_HUMAN | 1.67 | -0.57 | 1.50 | n/a | No Hit |
Items per page:
1 – 5 of 12
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood