rs11808959 chr1:64550716 G>A
- Sequence
tgtcttgcttttagatgtggcttc[G/A]tcactctttccaagcaatctccac
- ASB in cell types
- Th1-cells upper lobe of left lung
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 1.77 | -1.22 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, maternal transmission distortion, total cholesterol change with statins