rs11809572 chr1:100884750 C>T
- Sequence
aatgtttccctcaccactctccac[C/T]ctgagtattccagtgaactctgat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.84 | -0.63 | 1.63 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism with low iq, decrease in fev1 (in asthmatic participants >=30 years old), decrease in fev1 (in asthmatic participants), ldl cholesterol, salmonella-induced pyroptosis, total cholesterol
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Muscle_Skeletal