rs11809898 chr1:7019702 G>A
- Sequence
gcaaacttggtaaaaatgttcatc[G/A]agatggaaaacaagaacacagaca
- ASB in cell types
- liver
- ASB for transcription factors
- RXRA_HUMAN HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RXRA_HUMAN | 1.30 | -1.13 | 1.33 | n/a | No Hit | |||
| HNF4A_HUMAN | 1.28 | -0.68 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, ldl cholesterol, obesity with early age of onset (age >2), partial epilepsy, systolic blood pressure (sbp), total cholesterol