rs11849174 chr14:38608194 G>A
- Sequence
caagttgtctacctctaaaacaca[G/A]tggtcagatagacacaagatagac
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.65 | 0.01 | 1.74 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, microalbuminuria, triglycerides change with statins, type 2 diabetes