rs11856283 chr15:78696056 G>C
- Sequence
tttctccttcttcccagagacctt[G/C]ctctgcctgataaagctccagctc
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 1.90 | n/a | 2.00 | n/a | No Hit | |||
| GATA1_HUMAN | 1.39 | -1.72 | 1.50 | -0.99 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
