rs11860440 chr16:1707617 A>G
- Sequence
ggcctgcctgtgtgtgggcccaga[A/G]cctcgccctttgtcagaaacaggt
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.66 | -0.11 | 2.00 | |||
| GM12878 (female B-cells) | 1.34 | -1.35 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, hypertension (early onset hypertension), parkinsons disease (pd), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood