rs11868035 chr17:17811787 G>A
- Sequence
tcctcccgtgccacccagggacct[G/A]atggggacagagctgggaggtgag
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 1.49 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), college completion, parkinsons disease (pd), salmonella-induced pyroptosis, triglycerides, waist hip ratio
PheWAS abnormal heart sounds, acquired foot deformities, acquired hypothyroidism, acquired toe deformities, acute reaction to stress, adverse effects of antibacterials (not penicillins), anaphylactic shock nos, aneurysm of other specified artery, angiodysplasia of intestine, anomalies of tooth position/malocclusion, aortic aneurysm, asthma, atherosclerosis of native arteries of the extremities with ulceration or gangrene, bacterial infection nos, bronchopneumonia and lung abscess, bundle branch block, calcaneal spur, exostosis nos, cellulitis and abscess of trunk, cerebral edema and compression of brain, cervicocranial/cervicobrachial syndrome, chronic airway obstruction, chronic bronchitis, congenital pigmentary anomalies of skin, corneal edema, coronary atherosclerosis, cramp of limb, deficiency of humoral immunity, dental caries, diseases of hard tissues of teeth, disorders of binocular eye movements, disorders of muscle, ligament, and fascia, drug-resistant infection, duodenal ulcer, early complications of trauma or procedure, extrinsic allergic alveolitis, fasciitis, hyperosmolality and/or hypernatremia, inflammatory disease of cervix, vagina, and vulva, inflammatory diseases of female pelvic organs, known or suspected fetal abnormality, left bundle branch block, meningitis, methicillin resistant staphylococcus aureus, nephrotic syndrome without mention of glomerulonephritis, neuralgia, neuritis, and radiculitis nos, non-healing surgical wound, obstructive chronic bronchitis, occlusion of cerebral arteries, with cerebral infarction, other aneurysm, other forms of chronic heart disease, other headache syndromes, pleurisy, pleural effusion, pneumococcal pneumonia, poisoning by analgesics, antipyretics, and antirheumatics, polyarthropathy or polyarthritis involving multiple sites nos, pseudomonal pneumonia, raynauds syndrome, reflux esophagitis, respiratory failure, respiratory failure, insufficiency, arrest, retinal drusen, rheumatic fever / chorea, secondary malignancy of bone, secondary thrombocytopenia, sepsis, sepsis and sirs, septicemia, shock, staphylococcus infections, subdural hemorrhage (injury), supraventricular premature beats, temporomandibular joint disorders, thoracic neuritis/radiculitis, ulceration of intestine, ulceration of the lower gi tract, vaginitis and vulvovaginitis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood