rs11872195 chr18:9710890 G>A
- Sequence
gaaaacaaaagaaaagaaacatca[G/A]tcatatcacaccacatttgtggct
- ASB in cell types
- CD14+ monocytes periferal blood macrophages
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.27 | -1.10 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg