rs1187322 chr9:84668402 C>G
- Sequence
cccagcgctgtgcccgccgcgacc[C/G]gggccatgggctggtgctccggag
- ASB in cell types
- foreskin keratinocyte CD34+ hematopoietic stem cells
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.21 | 1.31 | 1.60 | n/a | No Hit |
Items per page:
1 – 1 of 1