rs11876 chr16:2038311 C>T
- Sequence
gggcgagggcctttgctgctctgc[C/T]ggggcctgctgactgaaaggaatt
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 2.13 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, height, ldl cholesterol change with statins, overall disease severity in n370s homozygous gaucher disease, systolic blood pressure (sbp), tetrology of fallot, total cholesterol change with statins