rs11876993 chr18:56495957 C>A
- Sequence
agcattctcactacaaggtggaga[C/A]aaagattggagctgagggaggcca
- ASB for transcription factors
- NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -0.54 | 1.27 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, salmonella-induced pyroptosis, triglycerides change with statins, waist hip ratio