rs11878620 chr19:42243077 G>A
- Sequence
gtctcaggtggtttttaagcccca[G/A]gtggatactgcagttccggagatg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) CUTLL1 (T-cell lymphoblastic lymphoma 1) breast tumor tissue
- ASB for transcription factors
- ZN143_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | 1.55 | 3.34 | 3.50 | n/a | No Hit |
Items per page:
1 – 1 of 1