rs11890343 chr2:73829393 C>G
- Sequence
tcggtcctttacgccgcctttccc[C/G]ctcatttgcagatgctgcatcccc
- ASB in cell types
- periferal blood macrophages CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.24 | -3.68 | 2.50 | n/a | No Hit | |||
| SPI1_HUMAN | 1.57 | 0.31 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid