rs1189214 chr7:158782235 C>G
- Sequence
gtgtgagaacagatgtgagtgtaa[C/G]aacgagtgagaatgagtgaacaag
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.86 | 0.12 | 1.51 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.11 | 1.31 | 2.18 |
Items per page:
1 – 2 of 2