rs11895097 chr2:20525047 A>C
- Sequence
tctgagtgcagggaggacaactgc[A/C]tccccaggaggcccgggaggtcac
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.89 | -0.07 | 1.98 | |||
| HepG2 (hepatoblastoma) | 0.71 | -0.22 | 2.00 | |||
| GM12878 (female B-cells) | -1.50 | 1.45 | 1.44 |
Items per page:
1 – 3 of 3