rs11907476 chr20:50431311 G>A
- Sequence
gcaccctgtggccgcggcagccac[G/A]cccctctgcacccaccagtcctgt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.81 | -0.57 | 4.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, decrease in fev1/fvc ratio (in nonasthmatic participants), fasting blood glucose, ldl cholesterol, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in nonasthmatic participants), parkinsons disease, serum creatinine, years of education