rs1190983 chr14:100031649 T>C
- Sequence
actcagtgactagtcactgggctc[T/C]tcagggcatttcgtaataatttac
- ASB in cell types
- T47D (invasive ductal carcinoma) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | -0.56 | 1.01 | 1.47 | |||
| HCT-116 (colon carcinoma) | -0.47 | 0.81 | 1.33 |
Items per page:
1 – 2 of 2