rs1191554 chr14:29529628 G>T
- Sequence
tagcagaagtggagccgccaagag[G/T]tcatgattggtagtgaagggaaga
- ASB in cell types
- 22RV1 (prostate carcinoma) H929 (plasma cell myeloma) pancreas adrenal gland
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.63 | -0.24 | 1.38 | -1.91 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), schizophrenia, systolic blood pressure (sbp)