rs1191874 chr2:20030422 C>G
- Sequence
gggggaggtgctacacacacagat[C/G]tcgcaataactcactatcacgaga
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFIC_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | -2.08 | 2.13 | 2.00 | n/a | No Hit | |||
| ARI1B_HUMAN | -1.77 | 2.19 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Testis