rs11922359 chr3:193572723 A>T
- Sequence
agtttgttcatatacccagaaact[A/T]tgcaccgctgagtggtccctgaag
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney) RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.25 | n/a | 2.17 | |||
| HEK293 (embryonic kidney) | 0.21 | 0.59 | 1.51 | |||
| RH4 (alveolar rhabdomyosarcoma) | n/a | 2.16 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Uterus, Whole_Blood