rs11924934 chr3:156483579 A>G
- Sequence
atgctcatcatataaattctgcct[A/G]tgtctcacaagctacttgcatctc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.48 | -1.20 | 1.67 | -0.27 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting insulin, hdl cholesterol, homa-ir, obesity with early age of onset (age >2), primary rhegmatogenous retinal detachment, spine bone mineral density (bmd), waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial