rs11927531 chr3:24655549 G>C
- Sequence
tcatttttttccttctgccttcta[G/C]gtttagtgtttcttttgtagtttt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.48 | -0.29 | 1.72 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, fasting blood glucose, rheumatoid arthritis, total cholesterol, triglycerides