rs11954054 chr5:151456584 A>G
- Sequence
tctcccggccctctagtgagttta[A/G]ttgccccagagctggttggcgtcc
- ASB in cell types
- prostate tumor
- ASB for transcription factors
- HXB13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HXB13_HUMAN | 1.63 | -0.45 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic nephropathy in type 1 diabetes, infant head circumference, serum creatinine, triglycerides
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid