rs11958484 chr5:90658367 T>C
- Sequence
cggctttctttcatttggtaagat[T/C]ggttgcgcatctactccaagtcca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.27 | 0.94 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP maternal transmission distortion, paternal transmission distortion, rheumatoid arthritis, transmission distortion, triglycerides
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Spleen, Stomach, Testis, Thyroid, Whole_Blood