rs1195959 chr11:65169460 T>G
- Sequence
ggtgtttagtgaacgggctatgga[T/G]gctgccccactcactacttccttt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NCOR1_HUMAN KDM1A_HUMAN REQU_HUMAN HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NCOR1_HUMAN | -1.10 | 2.51 | 2.00 | n/a | n/a | |||
| KDM1A_HUMAN | n/a | 2.50 | 2.00 | n/a | n/a | |||
| REQU_HUMAN | -1.67 | 2.33 | 2.00 | n/a | n/a | |||
| HTF4_HUMAN | -2.02 | 2.05 | 2.00 | n/a | No Hit | |||
| MNT_HUMAN | -1.17 | 1.95 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 12
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood