rs11978062 chr7:130875506 G>A
- Sequence
gccacatggggacagcaggtggcc[G/A]gtctgtgcagtacctgtgttggga
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.23 | 0.85 | 1.96 | |||
| foreskin keratinocyte | 0.53 | n/a | 2.17 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.22 | 0.05 | 2.26 | |||
| HeLa S3 (cervical adenocarcinoma) | 1.41 | -0.42 | 2.00 | |||
| SK-N-SH (neuroblastoma) | -0.45 | 1.26 | 2.00 |
Items per page:
1 – 5 of 8