rs1201807 chr6:45553996 C>T
- Sequence
tatatgtgtgtgtatatgtgtata[C/T]gggtgtgtggtgtgtgtctatgtg
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.79 | -0.14 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, fasting blood glucose, ldl cholesterol change with statins, mitral annular calcium, total cholesterol change with statins