rs12022410 chr1:65688250 A>G
- Sequence
cctcaggagatgcttggctcctga[A/G]gtccctgaagttggagcacattta
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | -0.18 | 1.91 | |||
| HEK293 (embryonic kidney) | 0.83 | -0.26 | 2.00 | |||
| HEK293T (embryonic kidney) | -0.19 | 0.74 | 1.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP baseline acute-phase serum amyloid concentrations, body mass index (bmi), chronic kidney disease, coronary artery disease (cad), height (pygmy height), plasma c-reactive protein (female), plasma soluble leptin receptor (sob-r) levels, serum creatinine, tetrology of fallot