rs12025638 chr1:153483873 G>A
- Sequence
ctggtcatcctgccactcccctac[G/A]taaaaaagcaggtgaggcttcccc
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | n/a | 1.80 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), birth weight, diabetic retinopathy in type 2 diabetes mellitus, prop taste detection threshold, rheumatoid arthritis, schizophrenia, tetrology of fallot