rs12025814 chr1:70034434 C>A
- Sequence
tagttatctttcctctgtgaagcc[C/A]gtgtgaaaaatgagctttacttag
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.47 | -0.08 | 1.93 | |||
| foreskin keratinocyte | 1.15 | -3.27 | 2.67 |
Items per page:
1 – 2 of 2