rs12027422 chr1:69993971 A>G
- Sequence
taaatcagataatgaaagataaat[A/G]gttgtaacttaaattcttggccag
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -1.43 | 1.50 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, irritible bowel syndrome, ldl cholesterol change with statins, spine bone mineral density (bmd), total cholesterol change with statins, triglycerides, years of education