rs12030169 chr1:221478459 C>A
- Sequence
gctgttctgatacgacagagccaa[C/A]ttttatcagcatccttccctttta
- ASB in cell types
- HEK293 (embryonic kidney) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.25 | 0.56 | 2.05 | |||
| 22RV1 (prostate carcinoma) | -1.01 | 1.79 | 2.00 |
Items per page:
1 – 2 of 2