rs12031604 chr1:28113119 G>C
- Sequence
tctcagggcagaagttccagaata[G/C]agaactggaggcgggtggggtggt
- ASB in cell types
- periferal blood macrophages monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 0.34 | 1.92 | 2.00 | |||
| monocyte-derived macrophages | 0.94 | n/a | 2.50 |
Items per page:
1 – 2 of 2