rs12033825 chr1:36134710 C>T
- Sequence
tctcttctaatgttctggctccag[C/T]aggcaggcgcttagcctggcagct
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -3.09 | 2.05 | 3.00 | |||
| K562 (myelogenous leukemia) | 0.36 | 0.44 | 1.31 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Pancreas, Thyroid, Whole_Blood