rs12041259 chr1:2207111 G>C
- Sequence
tattctggaatggaggtgagtggg[G/C]ggccagtgagggctgggccggtga
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN SP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | -1.94 | 2.18 | 1.33 | n/a | No Hit | |||
| SP1_HUMAN | -2.10 | 2.16 | 1.33 | 3.82 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood