rs12042111 chr1:26378326 T>A
- Sequence
agccccacttcctccctgaaaacc[T/A]taaaaacttcttcaacccatatcc
- ASB in cell types
- periferal blood macrophages K562 (myelogenous leukemia) SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive)
- ASB for transcription factors
- SPI1_HUMAN EVI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.92 | 0.61 | 1.54 | n/a | No Hit | |||
| EVI1_HUMAN | -0.74 | 1.00 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2